Skip to main content

Table 2 Primers applied in this study

From: Primary cilia and aberrant cell signaling in epithelial ovarian cancer

Gene Direction Primer sequence (5′ → 3′)
AURA (from [51]) Forward GCTGGAGAGCTTAAAATTGCAG
  Reverse TTTTGTAGGTCTCTTGGTATGTG
GAPDH Forward GAAGGTGAAGGTCGGAGTC
  Reverse GAAGATGGTGATGGGATTTC
GLI1 Forward GAACCCTTGGAAGGTGATATTC
  Reverse GGCAGTCAGTTTCATACACAGAT
PTCH1 Forward ATCAGCCAGTTGACTAAACAG
  Reverse GTTTCAGGCATGTAGTCGG